EST details — SGN-E570756

Search information 
Request: 570756Match: SGN-E570756
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C348382Clone name: 15389
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E570756Length: 239 bp (313 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E570756 [] (trimmed) CTTCACAAAGAAAACCTCTCTTTTTTTTTTTGCTTTCTGTGAAGCAAAATCAGAATGGCAAGCTTGTTTCATTTTTCCTTTTGGCCCTTATTGCC
ATTTCCATGGTTGCAACCACTGCTCTTAGCTGCTGATGCCCAGTACACTTGATCGTTCAACTGGTATTGGTCCAGGGNAGCTTGAAGCCAACACA
ATGGCTGGCACAATGTACAAGAAGATGTAGCAAGACACAGTACCACAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E570756] SGN-U270670 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T372153 [Download][View] Facility Assigned ID: bf_stolxxxx_0048d04.t7m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0331 Quality Trim Threshold: 14.5