Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E570863

Search information 
Request: 570863Match: SGN-E570863
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C348503Clone name: 15514
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E570863Length: 391 bp (969 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E570863 [] (trimmed) ATTTATTTTCATCCTTTCTCTCTCTACCTTAAACTTTCTCTTTCTAGATCTGGGATCCCCAAATTTCTCCTCATTTTCTCTTTACCATTTCTCCT
ATTCTCATTTTCATTCACCTTACTCCCTTTCCCCTCTTCCTACAATTCTCTCTGAATTTTCCCTTTCGTAGAATTAGGGTTAGGGTTTCACCAAG
AGAACAAAGATAACACCATTGGCATGTCTCGGTTTTCTTCTCTGCTGGGTTTTCATGCCATTCTGAAGAAACGCACTCTGAAAGTAATTGGAGAG
GTTAGAAGAAAAGGAAACCAAGAAGCTCCAAGGATACCACATTTTAACTCATCTTCGTTTTTTAACAAAGAAATTCTGGCATCAGGTCTTCTCAA
GAAGATCTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E570863] SGN-U273432 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T372274 [Download][View] Facility Assigned ID: bf_stolxxxx_0049f10.t7m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5