EST details — SGN-E571713

Search information 
Request: 571713Match: SGN-E571713
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C348822Clone name: 30754
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E571713Length: 764 bp (872 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E571713 [] (trimmed) CTTCGCCTTCGCCGTCCACAATTACCGAATCACAGGCAACCTAGCAAAAAAATCACACAAAGCTCCCATCGACGACGACATCGCCGGTGGACGGT
GACGGCGGGGCTGTACCTTCATCCTATAGATCCACCAATCAAAACCTCCTCGGCGTCAATTGGAAGAAATCAAGTCTAGATTCTAGAAGCTTCCG
GTAAATTATCAAATCTCCGTAAGTTTGGTTATCTATCTCTCAATTATCTCATCAGATGAACGAAGTGCTTACAGCTTCCGATGCATCTTCAAGTG
CGCGGTCGTATGCGTCGTCGATTTCACCTGTCAATGTTCCCCTCCTTTCCGCATTACTTGCCTGTGCTATTGCACAATTCCTCAAGCTATTCACC
ACCTGGTACAAGGAGAAGAGATGGGATTCAAAAAGGATGCTTAGCTCAGGTGGAATGCCATCATCACATTCAGCAACAGTTACTTCACTGATAAT
GGCAATTTATTTACAAGAAGGAGCTGGAGGATCTGTCTTCGCCATTGCTGTGGTTTTGGCATGTGTTGTAATGTATGATGCTACTGGTGTTAGGC
TTCATGCTGGGCGCCAAGCTGAATTGTTGAACCAGATAGTGTGTGAATTGCCTCCTGAGCATCCTGTTGCCAATGTTAGACCTCTGCGAGATTCG
CTTGGTCACACTCCCCTTCAGGTTCTTGCCGGTGCAGTGCTAGGATCTGTAGTGCCATTTCTGCTGAGAAGCTCAATCTAGAGTTCAACTTTATC
ATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E571713] SGN-U270971 Solanum tuberosum Build 4 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T372593 [Download][View] Facility Assigned ID: bf_ivrootxx_0001b04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0016 Quality Trim Threshold: 14.5