EST details — SGN-E571992

Search information 
Request: 571992Match: SGN-E571992
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C349137Clone name: 31076
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E571992Length: 648 bp (1280 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E571992 [] (trimmed) GTAGTGAAACAAAGGTTTATACTCTGGAAGAAGTAGCCCCTCACAACAATGCCAAAGATTGTTGGCTTGTTATTAGTGGCAAGGTGTATGATGTG
ACAAAATTCTTGGACGATCACCCTGGTGGCGATGAGGTCTTATTGGCTGCTACTGGAAAGGATGCAACCGATGATTTTGAGGATGTTGGTCACAG
CAGCAGCGCTCGAGCCATGTTGGACGAGTACTACGTAGGGGATATTGATTCAGCAACCATCCCGACTAAAAAGACGTACACTCCTCCCAACCAGC
CTCATTACAACCAGGACAAGACATCCGAATTCGTAATCAAGCTTCTCCAGTTCTTGGTTCCCCTGATCATTTTGGGCGTAGCAGTTGGCATCCGC
TTCTACACCAAACAATCTGCTTGAAGATTGAATGCAACGGTAAATTCATAATAAGTCCGAATTTGCAAGGAGTCACCCTCGATTCAAAAAAAAAA
TATCGAATTTTACTTCTTAGACTTTATATAGTCGTATGTTCTTGTTGTAATAGATTGTTGAGTCAATCCTTTAGAGTGTGGATTCAAAATTTTAA
ACTTGAGACGTTCAACATTTTAAGGTTCTTAGTATTGAATTCGACGTACCTTTGAAATTATGGGTTCAAACCAAAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E571992] SGN-U272671 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T372908 [Download][View] Facility Assigned ID: bf_ivrootxx_0004e02.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0035 Quality Trim Threshold: 12.5