Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E572378

Search information 
Request: 572378Match: SGN-E572378
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C349573Clone name: 31521
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E572378Length: 527 bp (681 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E572378 [] (trimmed) GGCATTAGTTAAATTGAAGTCAAAATCAGNCCTAGCATAGCATCAATGGTGTTCTACAAAAGCCATGAGAGTTGATAATTTGTACTCAATAGTTG
AGATTTTTTTTTCCTTCAGTATAAGCAGGAAGAAGCGTGCTGTGCAAGGCAAAGTGTTATTGAGTGAGGAGCTTCTCTACAACCACCCGGGGCCC
CTCTTCCACCTCCTTCCTCATCGGTTCAATCGAATAATCTGCAGAATTCTTCTGATCAAATCAGTATATAACAGAGGTCAGAGTGGAAGAGGCTT
TTTTGTTGTTGAATGGGAATATTATAGGAGTGATGAGGAAGTCTTTTAAAGATTCACTCAAAGCACTTGAAACTGATATTCAGCATGCTAATACT
CTGGCTTCGGATTATCCAAGAGAATATGATGGTGCTAGCCTTCAGATGAGACTATCGTACAGTCCCTGTGCTCATATATTTCTGTTTCTTGTTCA
GTGGACTGACTGTCACTTTGCTGGTGCTCTAGGATTGCTTAGGATCCATATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E572378] SGN-U272077 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T373344 [Download][View] Facility Assigned ID: bf_ivrootxx_0009b03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0081 Quality Trim Threshold: 14.5