EST details — SGN-E573027

Search information 
Request: 573027Match: SGN-E573027
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C350309Clone name: 32273
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E573027Length: 579 bp (810 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E573027 [] (trimmed) GGCACGAGGCATGGGGGGTGGAAAGACCACTATCATGGTACTCAATGTTGATCTTCAATGTTCAAGCTGCTACAAAAAGGTCAAAAAAATTCTCT
GTAAATTCCCTCGAATAGAAATTAGAGACCAAGTATATGATGAGAAGGGCAATACAATCACAATCACTGTGGTTTGTTGTAATCCTGAAAAACTT
CGTGACAAATTGTGTAGTACAGGATGTGTTTTAATCAAAAGCATTGAAATCAAAGACCCTCCAAAGCCCAAACCTCCCGAAAAGCCCAAAGAGCC
CGAAAAGCCCAAACAACCTGAAAAGCCTAAAGAACCCGAAAAGCCCAAACAACCTGAAAAGCCTAAAGAACCCGAAAAGCCCAAACAAGCTGAAA
AGCCTAAAGAACCCGAAAAGCCCAAACAGACTGAAAAGCCTAAAGAGCCTGAAAAACCTAAGCCCAAAGAGCCCGAAACGCCCAAAGAAGGTCCT
AAACCTAAACCAATTGCTCCACCAGCAGACCCCAGCGCCCGTAATGCCAAATGCCAATTCAAGAATGCNCACAACCTGCACACGGATATTGTTGT
GGACAATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E573027] SGN-U280674 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T374080 [Download][View] Facility Assigned ID: bf_ivrootxx_0017a04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0134 Quality Trim Threshold: 20.5