EST details — SGN-E573084

Search information 
Request: 573084Match: SGN-E573084
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C350374Clone name: 32340
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E573084Length: 467 bp (627 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E573084 [] (trimmed) TATATCTCCCACTTTGACTGAGGCGGCTGGTGCAATTATTGACGATTCTTTCACCCGATGCTTCAAGTCAAATCCACCAGAACCTTGGAACTGGA
ACATCTATTTGTTTCCTTTATGGTGCTCTAGGGGTTGTTGTTAGATATGGAATTCTTTTTCCTATAAGAGTCATTGTCTTGACAATAGGATGGAT
AATATTTCTGTCTTGCTATATCCCGGTGCATTTACTGCTGAAAGGGCACGATAAGTTCAGGAAAAAGCTAGAGAGGTGCCTGGCTGGAGCTGATA
TGCAGTTTCTTTGTTGCATCTTGGACTGGGGTTGTCAAATTCCATGGCCCACGAGCTAGCATACGACCTAAACAGGTTTATGTGGCAAATCACAC
TTCAATGATTGACTTTGTTGTCTTAGAGCAGATGACTGCATTTGCTGTGATCATGCAGAAGCATCCTGGGTGGGTCGGACTACTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E573084] SGN-U270916 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T374145 [Download][View] Facility Assigned ID: bf_ivrootxx_0017f11.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0164 Quality Trim Threshold: 14.5