Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E573263

Search information 
Request: 573263Match: SGN-E573263
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C350576Clone name: 32546
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E573263Length: 685 bp (995 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E573263 [] (trimmed) GCACGAGGAAGATTTAGAGTTTGGATTCATGGAAAATTGAGAAGAAATCTCCATGGATCGAGTTCTCAAAGCTGCGAGAACTTCTGGTTCTCTCA
ACCTATCGAATCGTTCTCTGAGTGAGGTGCCCATTGACGTATACAAAAGTTTGGATGCAGCCAGTGAGGATGAGAAGTGGTGGGAGGCCGTGGAG
CTACAGAAGCTGATTTTGGCTCATAATGACATAGAAACATTGCAGGAAGACATTCGAAATTTACCTCTACTGTCAGCGTTAAATGTTAGTCACAA
CAAGCTAACCCATCTTCCAGCTGCTATTGGAGAGCTTCATATGCTGAAGTCGTTAGATGTATCATTTAACTTGATAGTGAACATTCCAGAAGAGA
TCGGAACAGCAGCTTCTCTAGTCAAGCTTGATTGTTCAAACAACCAACTAAATGATCTCCCTAACTCCCTTGGAAGATGTGTGGAGTTATCAGAC
CTCAAGGCATCGAACAATAGCATTTCCAGTTTGCCAGCAGATCTAGCGAAGTGTTCAAAATTAACAAAGTTGGATGTCGAGGGAAACAAGTTAAC
TACCCTACCTGAGAGTTTGATTGCATCTTGCAGAATGCTTACTGAACTCAATGCATCAAAAAATTTGCTCAATAGCATTCCAGAAGATATAGGAA
GCCTTTCACGCTTGATTCGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E573263] SGN-U276043 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T374347 [Download][View] Facility Assigned ID: bf_ivrootxx_0019h01.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0050 Quality Trim Threshold: 20.5