Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E573323

Search information 
Request: 573323Match: SGN-E573323
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C350644Clone name: 32616
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E573323Length: 424 bp (723 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E573323 [] (trimmed) TTTTCTAGATAACTATGGGTAGTTTGGAAGTTGAGAAAACAGCTATTGGCTGGGCTGCAAGAGATCCTTCTGGTGTACTTTCACCTTATACCTAC
ACTCTAAGAAACACAGGGCCTGATGATGTGCAAGTCAAAATTTTGTACTGTGGACTTTGTCACAATGATCTTCACCAGGTTAAAAATGATCTTGG
CATGTCCAATTACCCTATGGTTCCTGGACATGAAGTTGTTGGAGAAGTGGTGGAGGTAGGGCCAGAGGTAACAAAATTCAAAGTGGGGGATATAG
TTGGAGTTGGATTGCTTGTTGGATGTTGCAAGACTTGCAGGCCTTGAAGCAAGACATTGAGCAATATTGTGCTAAGAAGATATGGAATTGCAATG
ATGTCTACACTGATGGCGAAGCAACCAAAGGTTGGTTTTGCTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E573323] SGN-U273888 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T374415 [Download][View] Facility Assigned ID: bf_ivrootxx_0020e11.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0043 Quality Trim Threshold: 20.5