EST details — SGN-E574471
Search information |
Request: 574471 | Match: SGN-E574471 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C351945 | Clone name: 33944 |
| ||
Library Name: IVROOT | Organism: Solanum tuberosum |
Tissue: Root
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E574471 | Length: 162 bp (258 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E574471 [] (trimmed)
TTTAGCAACAATGGCAAAGGCCCTTGTCCTTTTACAAGTTTCAGTTTTCTTACTGAGCTCATTCACAATTGTTAGCCATGCTCAAGATGAGTGGT
ACTCATTAGACAAAAATGTTGATCACCGTTGCACCAGCTCAAGCCCCTAAGCCACACCACCACCACC
ACTCATTAGACAAAAATGTTGATCACCGTTGCACCAGCTCAAGCCCCTAAGCCACACCACCACCACC
Unigenes |
Current Unigene builds | |||||
[SGN-E574471] | SGN-U272986 | Solanum tuberosum | Build 4 | 8 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T375716 [Download][View] | Facility Assigned ID: bf_ivrootxx_0034d09.t3m |
Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.947 | Expected Error Rate: 0.0276 | Quality Trim Threshold: 14.5 |