EST details — SGN-E574762

Search information 
Request: 574762Match: SGN-E574762
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C352275Clone name: 34281
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E574762Length: 346 bp (900 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E574762 [] (trimmed) TGAGAAGTATAATCTGAATGTGCGTCTCACACCCAACCAAGAGTATTATCTTGAGCAATATTCGGCAATCTTGGAAGCGCTCCATCACCACATTC
CTTGCACAGGGTGGTTTGCTGGTTTGTGAGATCCTCTCAATCTAACAGCAATGGTGTGCCCAGCTTTTCCACTTTGTCCTCTAGCAATAACTGAA
ACTGAACGTGGAATACCTGACATCCTCAAGCGCGTTAGAGCTATGTTTGATAAGGTTGGCCTGAGGTTCTATGAATCTGTTGTCATAAGGGTAAC
AGGTTGTCCCAATGGATGTGCTCGACCATACATGGCTGAACTTGGATTGGTTGGAGATGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E574762] SGN-U269853 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T376046 [Download][View] Facility Assigned ID: bf_ivrootxx_0037h10.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0198 Quality Trim Threshold: 20.5