Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E575557

Search information 
Request: 575557Match: SGN-E575557
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C353175Clone name: 35201
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E575557Length: 685 bp (895 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E575557 [] (trimmed) AAAGTTATCATCATGAACACCCTGGTCAGATTGGAAACGGATATGCCCCAGTGCTCGACTGCCACACCTCCCACATTGCTGTCAAGTTTGCTGAG
ATCTTGACTAAGATTGACAGACGTTCTGGTAAGGAACTTGAGAAGGAGCCCAAGTTTTTGAAGAATGGTGATGCCGGTATGGTTAAGATGATTCC
CACCAAGCCCATGGTTGTTGAGACCTTCGCTGAGTACCCACCATTGGGACGTTTTGCTGTGAGGGACATGCGTCAAACTGTTGCTGTTGGTGTCG
TCAAGAACGTCGACAAGAAAGACCCTACTGGTGCCAAAGTCACCAAGGCTGCCCAAAAGAAGAAGTGATGTGTTTTTGATGAGATTCTGCATTGA
TGAACTAGTTTTGTTTAATTGCATTAGCTATTTTCAATTTTGTTATGAACATTTTACCAGTCATAGACACGGCTCCAGAAGCTTTTGTCATGGTT
CTCTAGCCTCGTTTGAGGATAGTGGAGTTGTTGAGCAATTTGGTTTGATCCAAGTTGCTTGCATGGGCAGTGACAATAGCACCTTTGGATGTCTT
TCTCCTGTTCTGGTTTTTTTTTATAGCGAATTCCAAGATGAGCTGCTGAAACGGTTTTAATATGTTATGCTTTTAAGATATATTTTCTCCTTGAA
AAAGAGGATGGAAGAAGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E575557] SGN-U277731 Solanum tuberosum Build 4 274 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T376946 [Download][View] Facility Assigned ID: bf_ivrootxx_0047e08.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0077 Quality Trim Threshold: 12.5