EST details — SGN-E576548

Search information 
Request: 576548Match: SGN-E576548
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C354297Clone name: 59783
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E576548Length: 306 bp (1119 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E576548 [] (trimmed) ATGAGGGCAAGAGGTCAAGGGCGCACCGGAAAATCATCCAGATGAGGATGTCATCGTTATTTAGTTTCTTCCTTTTTCATAATCATCATTTGTAG
GCAATACATTCTGTCTATTTAGATTCTGGAGCTGAGCTGCCAAACATTGTATTTCAGCTCAATGGATTATAGTGCCAACTTTGCTGTCGCATGAA
TTGTGCAAGATAACGTAAGATGTCTTTGTATGTTATGTTATTACTCTTTAGTTGTGATGAACCCCTGAATTAGACTGCTTCAGTTTGTTTTCAAA
AAAAAAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E576548] SGN-U277612 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T378068 [Download][View] Facility Assigned ID: bf_ivrootxx_0061a10.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0022 Quality Trim Threshold: 12.5