EST details — SGN-E576890

Search information 
Request: 576890Match: SGN-E576890
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C349008Clone name: 30944
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E576890Length: 342 bp (441 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E576890 [] (trimmed) AGGGTTTTAGCGAAGCTCTTTCTCTCATTTTTTCGTTTGTGAAAGTTTTTTAGACATCATGGGTAAAGAGAAGATTCATATCAGCATTGTTGTCA
TTGGACATGTCGACTCTGGAAAGTCGACCACTACTGGTCACTTGATCTACAAACTTGGTGGTATTGACAAGCGTGTCATCGAGAGGTTTGAGAAA
GAAGCAGCTGAGATGAACAAGAGGTCCTTCAAGTATGCGTGGGTGCTTGACAAGCTTAAGGCTGAGCGTGAACGTGGTATTACTATTGATATTGC
CTTGTGGAAGTTTGAGACCACAAAGTACTACTGCACTGTGATTGATGCCCCTGGACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E576890] SGN-U277731 Solanum tuberosum Build 4 274 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T372779 [Download][View] Facility Assigned ID: bf_ivrootxx_0003b02.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0002 Quality Trim Threshold: 14.5