Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E576965

Search information 
Request: 576965Match: SGN-E576965
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C349648Clone name: 31598
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E576965Length: 162 bp (242 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E576965 [] (trimmed) GCACGAGGTTTGATTCTGTGGTCTGTAAATCATGGCTACACAAGGTCAAGTCATCACCTGCAAAGCTGCGGTGGCCTGGGAACCCAACAAGCCTT
TGGTGATTGAGGATGTGCAGGTGGCCCCACCGCAAGCCGGTGAAGTTCGGGTTAAAGTTTTGTATAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E576965] SGN-U269545 Solanum tuberosum Build 4 33 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T373419 [Download][View] Facility Assigned ID: bf_ivrootxx_0009h09.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0088 Quality Trim Threshold: 20.5