Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E577173

Search information 
Request: 577173Match: SGN-E577173
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C351422Clone name: 33410
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E577173Length: 739 bp (1113 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E577173 [] (trimmed) TAATCTCAGGCTTCACTCTCTCGTTCTTTCTTCATTAGTATCCCTCTTCCATAATCATCTTTCAGTTCTCTTTTAACATAGGGATCACCAACAAG
GAGAAATGGGGTTGACATTCACCAAGCTTTTCAGCCGGCTTTTCGCCAAGAAAGAAATGCGAATTCTCATGGTTGGACTTGATGCAGCTGGTAAG
ACCACCATATTGTACAAGCTCAAGCTGGGCGAGATCGTTACTACTATTCCTACCATTGGTTTCAATGTGGAGACTGTTGAGTACAAGAACATCAG
CTTCACTGTTTGGGATGTCGGGGGTCAGGACAAGATTCGTCCATTATGGAGACACTATTTCCAGAACACTCAGGGTCTCATTTTCGTGGTTGATA
GCAATGACAGAGATCGTGTTGTGGAGGCAAGAGATGAGTTGCATAGGATGTTAAATGAGGATGAGCTTCGGGACGCAGTGCTTCTTGTTTTTGCT
AACAAACAAGATCTTCCCAATGCAATGAATGCTGCCGAAATAACTGATAAGCTTGGACTGCACTCTCTCAGGCAGCGTCACTGGTACATTCAGAG
CACCTGTGCAACATCTGGAGAGGGACTTTATGAGGGTCTTGATTGGTTTCCAACAACATTGCTAACAAGTCCTAAGGCACTGGAAGAGTTCTTGC
GGGTTGATACTGGGATGCAGGCAGATTTTATCTAGTTTCTTTCCCAAGTCGGTGTGGTTATGAACATTGTCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E577173] SGN-U268256 Solanum tuberosum Build 4 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T375193 [Download][View] Facility Assigned ID: bf_ivrootxx_0028h03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5