EST details — SGN-E577611

Search information 
Request: 577611Match: SGN-E577611
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C354716Clone name: LE15AG01
nocartOrdering Not Available
Library Name: LE15Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: 15 days post anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E577611Length: 768 bp (854 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E577611 [] (trimmed) AACAGTATATTACATCCCTTAATAGATGTAAACTTTCCTCTTTAATAGATTCAATGTCATCAACTATATAGAGTAACTGAATTGATAACAGAAAG
TGAAAAGAGATGGACTAACAAATTGAGGAATATGACTTAGTCGGAAACAAGCTCACCGGCTCAATCCCTTCAACTATAGGTCGATTAAGTCGACT
CACTGTATTAAACGTAGCTGAAAATCAACTTACAGGGTACATACCCCGGTCATTAACCAACTTATCCTCATTAATGCATTTAGATCTCCGAAACA
ACGGTATCTACGGTAACATCCCGACTAATTTCGGAAAATTACGGATGTTGAGTCGAGCTTTACTGAGTCGAAACAAGTTAACAGGTCCTATACCG
TATTCGATTTCGTATATTTACAGGCTTTCAGATTTGGATCTGTCATTGAACAAACTGTCTGGTACCATACCTCCGTCTCTTGGTAAAATGCACGT
ACTTGCAACGTTAAATCTTGATGGTAACCATATTTCTGGTACGATACCTCCTAGTTTGATGAATTCACGTATCAACATTTTGAATTTGAGTAAAA
ATGCTATGGAAGGTTATATTCCCGATTCATTTGACGAAAAATCTTATTTTATGGTAATGGATTTATCTTATAACAAATTAAAAGGAAGCATTCCA
AAATCGATATCGTCGGCGACGTTTATCGGTCACCTTGATGTAAGTCATAACCATCTTTGTGGACAGATTCCAGAAAGTTCTCCGTTTGATCATCT
GGAAGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E577611] SGN-U578838 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T378636 [Download][View] Facility Assigned ID: LE15AG01
Submitter: Virginie Garcia Sequencing Facility: PRI
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5