EST details — SGN-E577647

Search information 
Request: 577647Match: SGN-E577647
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C354752Clone name: LE15BC07
nocartOrdering Not Available
Library Name: LE15Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: 15 days post anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E577647Length: 282 bp (922 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E577647 [] (trimmed) CAGCAAGCAGTTAGCCTTCCTCTACAAGGAATGGAAGTGTGGATGAATCGACATCAAATATAGGATTGTTGTTGTACACGATCTCCATTTTAGTA
GTCCTAGCTATCCACTCCACTATGTGGTAGAGTGTTCGTCCCAACCCCTTCGCAGGGGTACCTTCCCTTTTAATTGAGAGAAGGACTCGGAATTG
ACTCCCCTCGATTCGAGATCCGAAAGAAGGGTATAGAGTTTATCCAAGGAATGCTCTCCCGTGGCGGTACGCGGATTCTCGAGGGGGGGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E577647] SGN-U597963 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T378648 [Download][View] Facility Assigned ID: LE15BC07
Submitter: Virginie Garcia Sequencing Facility: PRI
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5