EST details — SGN-E577888
Search information |
Request: 577888 | Match: SGN-E577888 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C354993 | Clone name: LE08BA01 |
| ||
Library Name: LE08 | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Fruit
Development Stage: 8 days post anthesis
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E577888 | Length: 188 bp (831 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E577888 [] (trimmed)
CTACATCTCCTACCATACAATGCTTCAAATGGAGCCATATCAATGCTTGATTGATAGCTATTATTGTATGAAAACTCCGCTAAGGGTAGGAAGCT
ATCCCAATGACCACCAAACTCTATCACACACGCACGAAGCATATTCTCCAACACTTGAATCGTTCGCTCAGACTGACCATCGGGAGAACTAGT
ATCCCAATGACCACCAAACTCTATCACACACGCACGAAGCATATTCTCCAACACTTGAATCGTTCGCTCAGACTGACCATCGGGAGAACTAGT
Unigenes |
Current Unigene builds | |||||
[SGN-E577888] | SGN-U599718 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T378735 [Download] [View] | Facility Assigned ID: LE08BA01 |
Submitter: Virginie Garcia | Sequencing Facility: PRI |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.950 | Expected Error Rate: 0.0018 | Quality Trim Threshold: 12.5 |