EST details — SGN-E577995

Search information 
Request: 577995Match: SGN-E577995
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C355100Clone name: LE08CE10
nocartOrdering Not Available
Library Name: LE08Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: 8 days post anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E577995Length: 723 bp (803 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E577995 [] (trimmed) ATGAGAGAATGATGTTGATATTCATTGAAAGTAGGTGATCAAGATATGCTTGGAGAGTAATATCATGAAAACATATAACTACAAATCAACAAGCA
ATGCCAAAAAATAAAGTTATGGTTTTTGAGGGCATCAAAATTAGTGTCCAAACAAATATGCTATCAGGTTCCAGGTTCTACTTCTTGCTGAGATC
AATCCCAGCTTTCTTGGCTACAGCATCAAGTCCATTTTTCTCAATGGTCTTTATGGCCTTTGTTGACAACCTCAGTTTCACGAATCGTTTGCCTT
CCTCCCACCAAATTCTCTTGTATTGAAGGTTTACGAATTGCAACTTTTTCGTTTTGTGGTTTGAATGAGAGACCTTGTTTGCCCTGTTGGACTTC
TTGCCAGTGAAGGGGCATACTCTACGAGCAACAGGTTGAAGGGCTGTCTTGAAAGGAACAGAAAGTGAAGCAGGAGAGCTCAAATGGGTGCTTGA
AATCTTGATGCCACTCAATTGAGAAGTCACAAAACTCAACTCTGAGCTGAATTTCACCTTGGGTAAAGCCCTTTTGGTCACTGCAAATGTCCTGT
AACCACCCACTACTGGTCCTCTGAGGCTTATACCCGCTGTGATTGTCGCCATTTTTGCAACCAATTCCTCAAAGCAAGAATCTTTCCGAATACCT
GAAATAGAGATAATCATAGAAAATGTGAAATATTTGATAGGATCCATTTCGGGAACGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E577995] SGN-U582646 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T378809 [Download] [View] Facility Assigned ID: LE08CE10
Submitter: Virginie Garcia Sequencing Facility: PRI
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5