EST details — SGN-E578016

Search information 
Request: 578016Match: SGN-E578016
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C355121Clone name: LE08CH01
nocartOrdering Not Available
Library Name: LE08Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: 8 days post anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E578016Length: 730 bp (801 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E578016 [] (trimmed) TTTGTAGTTGATATTAATAGTGGAAGATGGGATGCTGTACTACCTCAAGTTGCACAACTTAAGCTTCCTAGAAAGATACTGGAGGATTTATATGA
GCAGATTGTCTTAGAAATGATTGAACTTCGAGAGATGGATACTGCACGAGCTATTTTAAGGCAAACCAACGTGATGGGTGTCATGAAACAGGAGC
AACCAGAAAGATATTTGCGGCTCGAGCATCTACTAGTCCGGACTTACTTTGATCCCCATGAGGCTTATAATGACTCAACCAAGGAGAAAAGGCGT
GCCCAAATTTCCCAAGCGCTTTCTGCTGAGGTTTCTGTTGTTCCACCATCACGCCTAATGGCTTTGATTGGTCAAGCCTTGAAATGGCAACAACA
TCAAGGTTTACTTCCACCTGGAACACAGTTTGATCTATTCCGAGGAACAGCTGCTATGAAACAAGATGAAGAGGATATGTATCCGACAACACTTG
GTCACACTATTAAGTTTGGTAAGAAGAGTCATCCAGAATGTTCTAGGTTCTCACCGGATGGACAATTTCTTGTCTCATGCTCAGTTGATGGATTT
ATTGAGGTCTGGGATCACATAAGTGGAAAACTGAAGAAGGATCTTCAATATCAGGCTGATGAAACTTTTATGATGCATGATGATGCTGTCCTTTG
TGTTGATTTTAGCAGAGACTCGGAGATGCTCGCGTCTGGGTCACAAGATGGAAAAATAAGGTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E578016] SGN-U563793 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T378826 [Download] [View] Facility Assigned ID: LE08CH01
Submitter: Virginie Garcia Sequencing Facility: PRI
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5