Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E578281

Search information 
Request: 578281Match: SGN-E578281
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C355386Clone name: LE12BG07
nocartOrdering Not Available
Library Name: LE12Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: 12 days post anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E578281Length: 684 bp (789 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E578281 [] (trimmed) CAAACCATCCACTCAAATTTAAGAAACCAGCAAAGCTAACACAGCCCATGTTTTTTTATGGTTAATGATCGGCAAAAACTAGTACAACATCCACT
GAAAAGCAGCACTACAGTCATGTATTATGAATGGTTCAACCCCAATTCAAAAGGCGTCAAATGATAAATACATAGAAAACAAGGCTCAGCAGCTC
CAATATAACTTTATTCTAAGACAGACACCACCGCTAGTTGCTGAATCTTCACCTCACCGGAGCAGTTAACCCTGGAGGCCAATAATACCACAAGC
AATCCTTCCGCCAGCATTTCCGGTGCTTTTACTGAGCTCATGTCCTCCCTTTCCAAGATCATCAGGATCAGCATGAACAACAACAGCTCTTCCAA
TGATGGACTGTGGACCAGTGAGAGGAATCTGCTTGTCGGTAATAGTAAAAGATGCAGTACCATCTTCTCCAACTGTGATGTTACCAAGATCACCA
GCATGACGCACCTCATCTTCAGGAGCACCATGCTCCTTACCAGCAGGATTGTAATGTGGTCCTGTTGACATACAGCCATTTGTGGTATCACCAAG
GGCATGGACATGGAAGCCATGAAGTCCAGGTTTTAGGCCAGAAATATTTCCATTAACTGTGGTTGGAGCATCTCCATCTTGAGTGAAGAGGATGG
TGCCACTTACACCTTCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E578281] SGN-U581590 Tomato 200607 Build 2 168 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T379134 [Download] [View] Facility Assigned ID: LE12BG07
Submitter: Virginie Garcia Sequencing Facility: PRI
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5