EST details — SGN-E578368

Search information 
Request: 578368Match: SGN-E578368
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C355473Clone name: LE12DA01
nocartOrdering Not Available
Library Name: LE12Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: 12 days post anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E578368Length: 746 bp (896 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E578368 [] (trimmed) GTAACAATTTTTTCTTTCCCATATAAGCTGTTCTCAAATATCTTTTCCACCGTATTAACTTGGAAAATATAGACCAGTAATACAAAGTCGTAGGC
CAGATAAGAGCACTTGTAAAGACAATTTCAGCCTAAGAGTTTCCAAACAACGGATAGTCATTTAAAATTCAAAATCGATGGAACTCATATAAAGA
GCCATCAACATTCAACAGCTTAATAAATAGACGAAACCGATATAGCAAAAACATAAAAAAGTACCAAATATAATAGAATAGTTTATACTGAGAAT
AAAACTAGAACTGTTCACACTTAATCGACCTCCTCAATCTTGGGGCCTGCACCGGTAGAACCAGCTGGAGGAGCATCATCATCATCCATAGGTGC
ACCTGCCTCACCACCAGCACCCTGGTACATCTTTGCAATTATGGGATTACATAGGCTCTCCAGTTCCTTCATCTTATCTTCAAACTCATCAGCTT
CAGCAAGCTGGTTGCTATCAAGCCATGAAATTGCCTGATCAATGGCATCCTCAATCTTTTTCTTGTCGTCTGCACTAAGCTTAGAACTAATCTTA
TCATCCTTTATAGTGTTCCTCATGTTGTAGGCATAGTTCTCAAGTGCATTCTTGGCCTCAACCTTTTTCTTGTGCTCTTCATCCTCTGCCTTGTA
CCTCTCTGCTTCCTGGACATCTTCTCAATTTTCTCCTTTGATAACTACCCTTGTCAATGGTAATAGTGATCTTGGTCTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E578368] SGN-U579878 Tomato 200607 Build 2 84 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T379289 [Download][View] Facility Assigned ID: LE12DA01
Submitter: Virginie Garcia Sequencing Facility: PRI
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5