EST details — SGN-E578452

Search information 
Request: 578452Match: SGN-E578452
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C355557Clone name: 85569
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E578452Length: 203 bp (284 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E578452 [] (trimmed) GAGACTTTATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGTGCTGTCCTCATTATTGACTCCACCACTGGTGGTTTTGAAGCTGGTATC
TCTAAAGATGGTCAGACCGTGAACATGCATTGTTGCTTCACCTTGGTGTCAGCAATGATCTGTGTTGTACCAAGATGGATGTTACCACCCCCAAG
TACTCCAAGGCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E578452] SGN-U289657 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T379328 [Download][View] Facility Assigned ID: bf_stolxxxx_0053b05.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0344 Quality Trim Threshold: 14.5