EST details — SGN-E578590

Search information 
Request: 578590Match: SGN-E578590
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C355695Clone name: 85709
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E578590Length: 708 bp (1016 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E578590 [] (trimmed) AATGATGGATATGTTTCTTCTCTGTAAGTAGTTGAGCTTCAGTAATTTTCACTCTACATAATCATAACACCTAAAGTAAACTTTGTTTTTCCCTT
CATCAGTGGACTACCTAGTCAAAGTTTATCTGGAACCTTGTCACCTGGAATTGGAAACCTCACCAAATTGGAATCAATATTGCTGCAAAACAATG
CTATTTATGGTCCTATTCCTGATGTGGTTGGTAATTTAGAAAAGCTTCAGACACTTGATCTCTCCAACAACAAGTTTGATGGCGAAATACCTGCT
TCTTTCGGAGATCTCAATAATTTGAATTATTTACGATTAAACAACAATAGCCTCACAGGAACCATTCCTCAATCTCTCTCAAACATTGGAGGCCT
CGCTCTCGTGGATGTTTCTTTTAATAATCTAAGTGGTCCATTGCCCAAAATATCTGCAAGAGCTTTCAAAGTTATTGGAAATCCTTTGATTTGTG
GCCAAAGTTCGGGGAACAATTGTTCAGCAGTCTATCCAGAACCGCTGTCCTTCCCGCCAGATAGTTTAGGAGATCAAAGAGCAGGAAGTAAAAAC
CATCATGTGGCTGTTGCTTTTGGAGCAAGTTTTGGTGCTGCTTTCTTGGTTTTAGTAGTCATAGCACTGGTTCTTTGGTGGCGCTACCGACATAA
TCAGCAGATCTTCTTTGATGTCAATGAACAATATGATCCAGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E578590] SGN-U292649 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T379466 [Download][View] Facility Assigned ID: bf_stolxxxx_0054g02.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0048 Quality Trim Threshold: 20.5