Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E578680

Search information 
Request: 578680Match: SGN-E578680
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C355785Clone name: 85800
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E578680Length: 758 bp (1461 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E578680 [] (trimmed) ATTGTGAACACAACCGTGAATCTGAGGTTGCTCCGGCGTTAATTGCAGTTCATCCAACTCAAAAATCCGTCTCCGTTGCCGTCGGTTCGAATCTC
CGCGTCTTTAATCTTCAAGAAGGTTGTTCAGTATCATTGGTGGATGATTCAGGAGTGCACATGCATAAGGATTCAATAAGAGCAATTCGATATTG
GTGCTGAAGGAAAGCTCTTTGTATCTGCTGGCGATGACAAACTTGTTAAGATTTGGGTTACTGATTCTTGGCAATGCATAAGTTCAGTGTCATCC
GAGAAGAGAGTTACTGCTGTTGCCATCAGTAATGATGGGCGTTTTGTATCCTTTGCGGATAAATTTGGTGTAATTTATGCAGTTGAAATAGAAGG
TTCTCATGAAAATCAAAGTCTGCCCAATAAGAAGGCAGTCCCAATTCTCGCCCACTACTGCAGCATCATTACTAGTCTGGAGTTTTCACCTGACG
GACGATATATTATTAGTGCCGATCGAGACTTCAAAATCCGAGTCTCTGTGTTCCCGGAAAAGCCATCAGATGGGGCTCATGAGATTCAAAGTTTT
TGCCTTGGCCATTCAGAGTTTGTTTCCTGCCTTGCCTTCATCTGCAGCAAGGATTCCCAGCAGTGGTATTTGCTTTCGGGAGGTGGTGATTCAAC
TGTACGCTTGTGGCACTTCACTTGTGGTTCTCTTCTTGATACCTGTCATGTTGGAGAGACAGGACTATTACAGTCAAAAGAAGGAATAGATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E578680] SGN-U274733 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T379556 [Download][View] Facility Assigned ID: bf_stolxxxx_0055g06.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5