EST details — SGN-E579584

Search information 
Request: 579584Match: SGN-E579584
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C356604Clone name: 86714
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E579584Length: 765 bp (977 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E579584 [] (trimmed) AAGACTCTCACTTTTTTGGGTTACTTCTCTATCTCTTTGTAGCCATGTCTGAGGGAGAGAAGGTTTTGCCGACTGCATCCAAAGATGAGAAGTCT
GGGGCAGCTGAGAGTAAAAAATCTTCTGAGTCTTCCACCATGGAAGCACCATTAGGAGAGGGGAGAACAGCCTCTACTGCTGCAGCTGGAGCTGG
GGTCCAAAATCCCTTTGATTTCTCAGCCATGTCTGGACTACTCAATGACCCAAGTATCAAAGAACTAGCAGAGCAGATTGCAAAAGACCCTGCAT
TTAACCAGATGGCAGAGCAGCTTCAGAAGACCTTTCAAGGTGCGGCAGTGGAAGAAAGTGTCCCCAACTTTGATAGCCAACAATACTACTCTACA
ATGCAACAGGTTATGCAAAATCCTCAGTTTATGACCATGGCTGAGCGGCTTGGTAATGCATTGATGCAGGATCCATCCATGTCTGGCATGCTTGA
GAGTTTGTCAAACCCTGCTCAGAAGGAGCAACTTGAAGAACGGATGGCGCGCATTAAAGAAGACCCATCACTCAAACCAATCTTGGAAGAGATAG
AGAGCGGAGGACCAGCTGCAATGATGAGGTATTGGAACGATCAAGATGTTCTGAAGAAGATTGGTGAAGCAATGGGTTTTGCTGCTGGAGGAGAG
GGTGGTGCTACCTCTTCTGAAATACTGGGCCAGATGAAACAGAAGAGGCAATGAAGATGAATCTGTTGTTCATCAGTGTGCTAGTGTTGGTGATG
CAGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E579584] SGN-U268326 Solanum tuberosum Build 4 60 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T380460 [Download][View] Facility Assigned ID: bf_stolxxxx_0066a05.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5