Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E579867

Search information 
Request: 579867Match: SGN-E579867
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C356887Clone name: 87000
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E579867Length: 403 bp (934 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E579867 [] (trimmed) ATCGTCAGCTTCAGTATAAAGGCTCCTGGAAAAGAACAGCCCTGGATCAATTGAATGTGACTTTCGAAAATAATGAATCCTTCCAGAAAACGGTA
CACTTCAATGGATTCAACTCTGTATTCCTTTATCGTAGATTATACCGGTGCTATACATCATTGAATGGATTTTATTATGATACCGGAAATGTTGA
AAGAGCGAAGAACCTTTCTATAGATGAGTTTCGTGATAAGTATGATGGACAGAAACCGGTTTTAATTGGTGGATTAGCCGACACTTGGCCTGCAA
GGACTACATGGACAACAGAGGAGCTTTTAAAAAAATATGGAGATACAGCATTTAAATTATCTCAAAGAAGTCGTCACAAAATTAGGATGAAACTG
AAGGACTATGTGTCATATATGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E579867] SGN-U282241 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T380743 [Download][View] Facility Assigned ID: bf_stolxxxx_0069b03.t3ma
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0145 Quality Trim Threshold: 20.5