EST details — SGN-E580391

Search information 
Request: 580391Match: SGN-E580391
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C358263Clone name: 5634
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E580391Length: 262 bp (811 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E580391 [] (trimmed) TTGAACAAGACAAGCAGGATGTTGGCATTACTACTCATAAGCTAAATTTAGTGAATAAAGCACCAGCAAGAAGACATTCACATGCTGGTACTAGA
ACCACCGGCATGAAGATGGAGAAAATTAACGAAGACCCTGAAAAGAAACCTAAAAAGTCTGCTCGTCTATCTTTCATGGGGATTATGACGAACAA
ACGTTCTAGTACTACCATGACGATTGATGATGATGATTTTTGAGGCAAGGATGACCATGGCATAATGGACGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E580391] SGN-U274425 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T381267 [Download][View] Facility Assigned ID: ACDA00370G10.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0130 Quality Trim Threshold: 14.5