EST details — SGN-E580645

Search information 
Request: 580645Match: SGN-E580645
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C358517Clone name: 5888
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E580645Length: 197 bp (757 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E580645 [] (trimmed) CCCACTCTTATAATTATTCATCCACCAACTAACTCCCTGTATTCACAAATATTTTCTTTCTATCGACAATCCGGTGGATTTGCAGATAGGGCAAG
TGTTCTTCACAACCAACCACTTCTTTACGCACTCCGCGTGATATTCATGCCCGCAATCAAGAGTTCCTATAGTTTCTTGCTTGTTGTAATCAGTC
TGAAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E580645] SGN-U278979 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T381521 [Download][View] Facility Assigned ID: ACDA00630E06.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0103 Quality Trim Threshold: 20.5