EST details — SGN-E581471

Search information 
Request: 581471Match: SGN-E581471
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C359490Clone name: 6684
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C359490 [6684] Trace: SGN-T382409 EST: SGN-E581472 Direction: 5' Facility: GASF
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E581471Length: 514 bp (1000 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E581471 [] (trimmed) AGTCCGAGTTTTTTTTTTTTTTTTTTAAAGTGTGAAAATAATGCTTTACAAGGTAAAGCTGGCAAAATAGTTTTTTTTACAGACAAGTAAAATTC
ATGTTTTCACTACAACAATCACTCTACTATCCTGATCTCTATATACTATAAACTATAAAACACAACCCCATTAAAGAGAGGATTCACAAACTATA
AGAATTATGTGACTACTACTACTATATGATCGGTTTGGGACTGAGGCGTATTGTTGTACTACTACTATGTAATCAAACGTCAAAAGTTACATCCG
CGTTCCCCATCAAACAGACGTTGTTATAAGGAACCACCAAAATCGGAAACCAATGTTAGCCTAATAATCTGGTCATTCATGTACAATGGAGAACT
CATACCTCTTTTCCTTCGCAATAAAGCCTCTTCATCAGTCAAACGTTATCGATCATTTTGTGTCTGCATGTGATTTGTTTGATCCATCAAATGTT
ATGATCAAGCAGCAAGAACAAGTGCTTTTATTGTCCCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E581471] SGN-U280816 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T382317 [Download][View] Facility Assigned ID: ACDA01472C08.m13rm
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5