Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E581499

Search information 
Request: 581499Match: SGN-E581499
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C359652Clone name: 6699
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C359652 [6699] Trace: SGN-T382423 EST: SGN-E581500 Direction: 5' Facility: GASF
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E581499Length: 624 bp (718 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E581499 [] (trimmed) ATTGAAAAGAAAAAAAGACTATTTTTTTATGCAGTTCTTGATGGTCCAGTTCACTCAGCTATTCCAGAAGTTGTTGCTAGTAGAAAATCTCTTAG
TTTCAGCCTAGATTCCAATCCAGTATGGGCCTCTCACAGTATCCAACTCCAGCAGATGCAGGAGTGCTCTGTGTTATTCTAGTGAACACAGCCAT
ATCCATCTCCATTGTCAAGGAGATGGTCCGATCGATCCTTCATGTGATTGGCATCCATATTGCATCATGGGACGATTATTCCATCGAAGGCTCCT
TGGACTCGTTTGAATGTCGCAGAAGCCCATCAGAGTCATATATGGAGGAATTCAGAAGCCATACCCCTGCAATTCGTTATGATTCAATCTGTATC
TCTAACCATGCTGAGAAAGAGTGCTCCGTCTGCCTGACGGATTTTGAGCCTGATGCAGAGATAAACCATCTCTCATGTGGCCATGTTTTCCACAA
GCATTGTTTAGAGAAGTGGCTCAAGTACTGGAATGTAACTTGTCCACTTTGCAGGAATTACATGATGTCTCAAGAAGGCGAAGAAGATACTTGTC
CTATGTGAGGTTAGAAGTTTATCGAGGCTATAACACTACTATACATCTGGAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E581499] SGN-U270520 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T382331 [Download][View] Facility Assigned ID: ACDA01487D11.m13rm
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5