Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E581506

Search information 
Request: 581506Match: SGN-E581506
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C359662Clone name: 6702
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C359662 [6702] Trace: SGN-T382334 EST: SGN-E581505 Direction: 5' Facility: GASF
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E581506Length: 537 bp (953 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E581506 [] (trimmed) GTGGTTTTGAAGCTGGTATCTCTAAAGATGGTCAGACCCGTGAACATGCATTGCTTGCTTTCACCCTTGGTGTCAAGCAAATGATCTGCTGCTGT
AACAAGATGGATGCTACCACCCCCAAGTACTCCAAGGCTAGGTATGATGAAATTGTGAAGGAAGTTTCTTCCTACCTCAAGAAGGTCGGTTACAA
CCCTGCACAAAATCCCCTTTGTCCCTATCTCTGGTTTTGAAGGAGATAACATGATTGAGAGGTCTACCAACCTCGACTGGTACAAGGGACCAACC
CTCCTTGACGCTCTTGACCAGATTAATGAGCCCAAGAGGCCATCAGACAAACCCCTCCGTCTTCCACTGCAGGATGTTTACAAGATTGGTGGTAT
TGGAACTGTACCTGTTGGTCGTGTTGAGACTGGTGTGATCAAGCCTGGTATGGTTGTGACCTTTGGCCCTACTGGTTTGACAACTGAAGTCAAGT
CTGTAGAGATGCACCATGAAGCTCTCCAGGAGGCACTCCCCGGTGACAATGTTGGGTTCAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E581506] SGN-U277726 Solanum tuberosum Build 4 467 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T382426 [Download][View] Facility Assigned ID: ACDA01490E02.skm
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0032 Quality Trim Threshold: 20.5