Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E581797

Search information 
Request: 581797Match: SGN-E581797
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C360733Clone name: 7426
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E581797Length: 486 bp (1093 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E581797 [] (trimmed) GCTGCAGGCTAAAATGGAACATCCATTCTTCATCAATGGCCCTCCTACAAATCGATCTGAAGCTTTACGGTGGCTATCAATCGCCGAAAAGCTCC
TTACAAATCGTGATCTTGTTGGTAGCAAATCATTTGCAACTCGTGCCCGTGAATCCGACCCGTCTTTACTCACCCAATCGATCAAATCCTCAGCA
TCGTCGACACCTTAACTGCCGGCGACAAACGTATCAACAATCATCACTTTGATTACTACTCTATCCTTCAGATCCCTCCTAACCAAACCCAGAAC
TTCGAATTCATCGCCGATCAGTATCGTCGATTTGCTCTTCTTTTGAATCCTCAGAACAACAACTTTCCGTTTTCGGATCAAGCTTTTGGACTTGT
TGTTGATGCGTTTTCAGTTCTTTCTGATCCCTTGAGGAAAAGTATGTATGATAAAGAATTGGGTTTTTTTCTGAATCTTTACCCAGTTTGCTTCT
ACGCCTACACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E581797] SGN-U272648 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T382673 [Download][View] Facility Assigned ID: ACDA01742B02.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0049 Quality Trim Threshold: 20.5