Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E581895

Search information 
Request: 581895Match: SGN-E581895
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C360831Clone name: 7526
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E581895Length: 648 bp (1010 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E581895 [] (trimmed) GTCTTCTCCTTCACCCATTCTCTCTCTTTAAATATGGCTGAAAATAGTGGAGAAGGGATCGGAAGAAACTCAGGAACCTCTCGTGTTGCACTTAA
ATGAAAGAATTCTCTCCTCAATGTCACGAAGATCTATTGCTGCTCATCCGTGGCATGACCTAGAGATTGGGCCAGGTGCACCATCAATTTTCAAC
TGTGTGGTTGAAATAGGCAAAGGCAGCAAAGTCAAATATGAGCTTGACAAAGCAAGTGGCCTTATAAAGGTTGACCGAATACTGTACTCATCAGT
TGTTTATCCACACAACTATGGTTTCATCCCAAGAACCCTTTGTGAAGACAGTGATCCAATGGATGTCCTGGGTACTGATGCAGGAACCTGTGTTA
CCAAGTACGTTTCTTCGTGCTCGTGCAATTGGATTGATGCCTATGATTGATCAGGGTGAGAAAGATGACAAGATAATAGCAGTGTGTGCAGATGA
TCCCGAGTTTCGCCACTACACAGACATCAAGGAGCTTCCTCCTCATCGTCTTGGCTGAAATCCGGCGCTTTTTTGAAGACTATAAAAAGAATGAG
AACAAGTCAGTTGCCGTTGAGGACTTTCTTCCTGCTGAAGCAGCTGTAGATGCCACCAAGTATTCCATGGGACCTGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E581895] SGN-U281371 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T382771 [Download][View] Facility Assigned ID: ACDA01843B07.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5