EST details — SGN-E582168

Search information 
Request: 582168Match: SGN-E582168
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C361104Clone name: 7801
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E582168Length: 242 bp (966 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E582168 [] (trimmed) AATGAGCAGGCTCCGGCGACGAAGAAGCCTGTTCAAGGAGAAGAAACCTAGGGCTCCCAAAGAAGAAGAAGCCTAAATCTGCCAATGTCTGTTAC
TCATCCTCCTTATTTTCAGATGATTAAGGAGGCTCTGTTGGCTCTGAACGAGAAAGGTGGATCGAGTCCGTATGCAATTGCTAAATACATGGGAA
GACAAACACAAGGATGAATTACCAGCAAATTTCAGGAAAATTCTAGTCTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E582168] SGN-U270784 Solanum tuberosum Build 4 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T383044 [Download][View] Facility Assigned ID: ACDA02123A11.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0168 Quality Trim Threshold: 20.5