EST details — SGN-E582455

Search information 
Request: 582455Match: SGN-E582455
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C361391Clone name: 8088
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E582455Length: 229 bp (843 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E582455 [] (trimmed) CGTCTTACGATACAAGCAAAGATAGGAAGAACAAAAGGAGTGCACCACAAAGCAAAAACATTACAAAAGTGTAACTTATGGCCTAAATTTATTAA
CCTAGTAGTAATACATAGGCCATATATTTGCTCCTCAGCCTAGGAGGTATTACCAGCCGTATTCCAACTGTTGTTCCCCCTTCCTTCCAACGCGT
TACTCAACCATCCGACAGCTAATCTATACTGTTTTGACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E582455] SGN-U268920 Solanum tuberosum Build 4 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T383331 [Download][View] Facility Assigned ID: ACDA02420B08.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0195 Quality Trim Threshold: 20.5