EST details — SGN-E582556

Search information 
Request: 582556Match: SGN-E582556
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C361492Clone name: 8189
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E582556Length: 577 bp (1082 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E582556 [] (trimmed) GCTGAGTTCCGCAGACTAAACCCTAGCTCCTCCTTCTCCTTCACCCGTCGTCCCGCCGCTCTCTTTTCATAACCACATAACTTAGCCCGTATTTT
TTAGATCATTCTCCATAATCAGTAACACAATTAGATTATCGGAAAAGGCTTGGAGAGTGTATAAGGCTGCTTTTATCGTCTCTTGCCCCAAGTGT
AGCTGTTGGTGGATGCGTTCTTATTCATCTTCTATAGTTGAGGGCTAAGTTTTCTCTATGGCTTCCAGGAGTAGCATCCGTCTTATTTCATACTC
GGAAGAGATTATAAATGGTGAACCAATCTTTATTTCCTCTAACTGCTGTCCTATTAAAGCTCACAAATATGAGCCTGCTGGACTTGCTTTTCACT
CTGCTGCTCTTAGACTGATTGGGCATGTTGAGAAAGAAGACCCCAAAGATGGCAAAGAAGATGTTCCTAATGACAAGGAACAGACATTTGCCTAT
TCATCAGAGTCATACAGCTCTAAGGGGAACAAAGAAGTCTTCTACCGGCGAAAAAGGTACCAGATCATTATGCATTGGTTAGGGGTTTGAGCAAT
CTAAGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E582556] SGN-U269418 Solanum tuberosum Build 4 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T383432 [Download][View] Facility Assigned ID: ACDA02525C05.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5