Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E583151

Search information 
Request: 583151Match: SGN-E583151
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C362087Clone name: 8784
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E583151Length: 472 bp (951 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E583151 [] (trimmed) CTTCATAAGGAATACTTGGCACATATTTATATGCATAACTACAAAAGTTTCACTTTGTACTTTAGCTATGAAATAGAATTAGTGAACAGCTCCAT
CCATAATTTGTAAATAAATAATCTTTCCTGAATGTATAAATATGAAGATGAAGTGTTCTAGGCTTCTAGCAATATATAGCTATTTGATACAGAAA
TATGCTTTCAAGGATCTGAAAACAGAGAAAGGCTTCTTGCGATCAATTTCCCCGAGTGCTTTTATTTCCTGAAGGGACTACAACCAATGGAAGAT
CGATTATTTCCTTTCAACTTGGTGCATTTATCCCAGGATATCCTATCCAGCCTGTTATTGTGCGGTATCCCCACGTACATTGTGATCAGTCATGG
GGGAATGTATCCCTAGCAATGCTGATGTTTAGAATGTTCACACAGTTTCCACAATTTCATGGAGGTACGTAATGACTTGCAGTAAGAAAATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E583151] SGN-U271190 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T384027 [Download][View] Facility Assigned ID: ACDA03138F06.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0015 Quality Trim Threshold: 14.5