EST details — SGN-E584098

Search information 
Request: 584098Match: SGN-E584098
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C363034Clone name: 9919
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E584098Length: 514 bp (827 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E584098 [] (trimmed) TACTCTCTCGTTCTCTCCACCTTCCTTCTGCTTCTGCTTCCGCTTCTCTAGGAAGAAGCCATGGTGTGGCAAGGCACATCAACAGGTTTAGTACA
TCTGCAGCTGTTGAGGAATTAATCACTCCACCTGTCCAAGTTAATCACACCAAGCTTCTAATCAATGGGCAATTCGTTGATTCTGCATCTGGAAA
AACATTCCCAACGTTGGATCCAATAACTGGAGAAGTCATTGCAAATGTTGCTGAAGGTGATCTCGAAGATGTTAATCGCGCTGTGGCTGCTGCTC
GCAAGGCATTTGATGAGGGACCATGGCCCAAAATGAGTGCTTATGAAAGGTCACTGATAATGCTAAAGTTTGCTCATTTGGTGGAGAAACACAAT
GATGAGATTGCAGCTTTAGAAACATGGGATAATGGCAAGCCATATTTGCAGGCTGCCCAAGCTGAAGTACCTTCTTTTGTGCGATTATCCCGGTA
TTATGCTGGTTGGGCGGATAAAATTCATGGTCTAACTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E584098] SGN-U269701 Solanum tuberosum Build 4 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T384974 [Download][View] Facility Assigned ID: ACDA04119H03.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0132 Quality Trim Threshold: 20.5