EST details — SGN-E584838

Search information 
Request: 584838Match: SGN-E584838
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C357797Clone name: 10759
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E584838Length: 231 bp (845 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E584838 [] (trimmed) CCTTCAAATTCTTCTCAAAAATCTTTTTCTCCAAGCTTCCTCTTCCAGCAGCCTATTTTAACATCCCCTCGGCCCTTCAAGAATTTCCAAATCTC
ACACTAAAGAACGAGAGAAAGAGTAGTGAGCTGAATGGCAGGAGGTGGTTCAGCTGCTGGAAAGGGTGATGCCCCAAGTGTTAGGATAGTGGTTG
CAGGTGATGCTACAACTGGAAAGTCTAGCTTGATCTTGACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E584838] SGN-U270552 Solanum tuberosum Build 4 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T385714 [Download][View] Facility Assigned ID: ACDA04888H04.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0159 Quality Trim Threshold: 20.5