EST details — SGN-E587034

Search information 
Request: 587034Match: SGN-E587034
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C364047Clone name: 78146
nocartOrdering Not Available
Library Name: SLMWOrganism: Solanum tuberosum

Tissue: Assorted Stolon/Tuber Developmental Series
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E587034Length: 206 bp (1223 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E587034 [] (trimmed) AGAACATAAAGCCCCCAAGGCCTAGCTCAAGTGGCAAAAGGTGGAGGATTTGTGGCTTAGGTCGTAGGTTCAAGCCCCACACCATGCAAAGCGAA
GCCCGGTATTTAAGCGGAGAAGGGTAGAGGGGCGGGCCCATTATCCACCGAGTTTAGAAGGCTGTGATTGGTCCAAAGGGCGGGTCACAGACGGA
TTTCTCGTTTATCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E587034] SGN-U268091 Solanum tuberosum Build 4 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T387910 [Download][View] Facility Assigned ID: bf_slmwxxxx_0011c08.t3mb
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5