Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E587153

Search information 
Request: 587153Match: SGN-E587153
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C364166Clone name: 78267
nocartOrdering Not Available
Library Name: SLMWOrganism: Solanum tuberosum

Tissue: Assorted Stolon/Tuber Developmental Series
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E587153Length: 384 bp (1290 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E587153 [] (trimmed) CAAGCTTGGTTTGCACTCCCTCCGTCAACGCCACTGGTACATTCAGAGCACATGTGCTACCTCTGGAGAAGGGTTGTATGAGGGGCTTGACTGGC
TCTCAAACAACATTGCAAACAAGGGTTGAACATGAGATCCATGATTTTTGCAGCTATATTTTTGTCAATATAGACTTCAACAATGTCTAGAGCAC
TTGTGCACCTGCTGATCTTTCTTATGCGAGATAGATCCACTTATCACTATATTTTTTTCAGTACATTTTCCTTTCTTTAAAAGAATGTTACTTTA
CAGTAACTTTAGTTGAATTCATGTAATATTTTACACTCTGGGTTTACATATTCTCTCAATTACTCCGCTTTCAGCATTTTGTTTAAATTAAAAAA
AAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E587153] SGN-U268257 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T388029 [Download][View] Facility Assigned ID: bf_slmwxxxx_0012e09.t3mb
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0007 Quality Trim Threshold: 12.5