EST details — SGN-E587208
Search information |
Request: 587208 | Match: SGN-E587208 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C364221 | Clone name: 78322 |
| ||
Library Name: SLMW | Organism: Solanum tuberosum |
Tissue: Assorted Stolon/Tuber Developmental Series
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E587208 | Length: 185 bp (1134 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E587208 [] (trimmed)
CCTCGTGCCGAATTCGGCACGAGGCCTCGTGCCGAATTCGGCACGAGGGTCCAGCGTTACCTGCTAGAGGAGGGCCTTGACTACTCTGAGCCACA
ACCAGGGCTTCTCCGAGTTGTGATATACTGAGGTGTGAAGGTATAGGAGTTTTTGACACGTCATTATCCTAGAAAATCCATCAGATGAAG
ACCAGGGCTTCTCCGAGTTGTGATATACTGAGGTGTGAAGGTATAGGAGTTTTTGACACGTCATTATCCTAGAAAATCCATCAGATGAAG
Unigenes |
Current Unigene builds | |||||
[SGN-E587208] | SGN-U271063 | Solanum tuberosum | Build 4 | 14 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T388084 [Download][View] | Facility Assigned ID: bf_slmwxxxx_0013b05.t3ma |
Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.982 | Expected Error Rate: 0.0018 | Quality Trim Threshold: 12.5 |