EST details — SGN-E589562
| Search information |
| Request: 589562 | Match: SGN-E589562 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C366575 | Clone name: 43139 |
| ||
| Library Name: CSCH | Organism: Solanum tuberosum |
Tissue: Tubers
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E589562 | Length: 172 bp (241 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E589562 [] (trimmed)
TACGGAGAGTCAGTTTCCGGACAGTCAGATACAAAGTCATGCGGCGAGTTTTCATCTGAACAAGTCTGATCTCGAAAAGCTGGCTGCAAAGTCTC
TGTTCGGCGGCGGGAAGTTGTACCTTCAAATCTCAATTTACACCGGCAGGCGAGGGTCGACATGTGGTGTGAACTCT
TGTTCGGCGGCGGGAAGTTGTACCTTCAAATCTCAATTTACACCGGCAGGCGAGGGTCGACATGTGGTGTGAACTCT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E589562] | SGN-U273223 | Solanum tuberosum | Build 4 | 9 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T390438 [Download][View] | Facility Assigned ID: bf_cschxxxx_0023d11.t3m |
| Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.972 | Expected Error Rate: 0.0018 | Quality Trim Threshold: 14.5 |
Working
