Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E589625

Search information 
Request: 589625Match: SGN-E589625
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C366638Clone name: 43203
nocartOrdering Not Available
Library Name: CSCHOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E589625Length: 266 bp (491 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E589625 [] (trimmed) ATCTTCACAAGGGGCCCAAAAATCACTTGCTGTGGTTCTTAAAATATCGATAACAGCAATGAAGCCCAGATGATTGGAAATACATCCTTAAAATG
ACCATTTTAGTGGGAGGGCTGAAACTAATCTTTTTTTTTATATAACATTCTCATTGTATTTCTCTCTTTACAGCTCTTTTCTTCCAATATCTATT
TGTATTTGGTGGCAGCTTTTAATATTTGCCAAAAATTTATCACTATATTGCTCACCACTTTTTTGACTTATATAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E589625] SGN-U270690 Solanum tuberosum Build 4 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T390501 [Download][View] Facility Assigned ID: bf_cschxxxx_0024b03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.923 Expected Error Rate: 0.0180 Quality Trim Threshold: 20.5