EST details — SGN-E589770

Search information 
Request: 589770Match: SGN-E589770
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C366783Clone name: 43352
nocartOrdering Not Available
Library Name: CSCHOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E589770Length: 779 bp (1101 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E589770 [] (trimmed) TAATATCTCTCCATTGCCTCAATCTTTTTCTCCTGCATACTTTTAGAGAATGGGAAGCTCTGGTGGTATTAACTATGGTTCTTACACTTATGAGA
ATCTTGAGAGGGAACCTTACTGGCCATCTGAGAAACTCCGTATTTCCATTACTGGGGCTGGAGGATTTATCGCTTCTCACATTGCTCGTCGTTTG
AAGAGCGAGGGCCACTACATAATTGCCTCCGATTGGAAGAAGAATGAGCACATGACAGAGGATATGTTCTGTCATGAGTTTCATCTTGCGGATCT
TAGGGTTATGGATAATTGCTTGAAGGTAACAAAAGGTGTTGACCATGTCTTCAATCTCGCTGCTGATATGGGTGGCATGGGTTTCATTCAGTCCA
ACCACTCGGTTATCTTCTATAACAACACTATGATCAGCTTCAATATGATGGAAGCTGCTAGGATTAACAGTGTCAAAAGGTTCTTCTATGCATCT
AGTGCTTGCATATACCCCGAGTTCAAACAACTCGAAACAAATGTCAGCCTGAAAGAAGCTGATGCTTGGCCTGCAGAGCCTCAAGATGCATACGG
CTTGGAAAAGCTTGCCACAGAAGAACTGTGCAAACATTACAACAAGGATTTTGGAATTGAATGTCGTATTGGAAGGTTCCATAACATCTATGGAC
CTTTTGGAACTTGGAAAGGTGGAAGGGAAAAAGCTCCCTGCCGCTTTTTGTAGAAAAGCACANACTGCAACGGATAACGTTTGAACTTGTGGGGG
AGATGGGACTTCAAACACG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E589770] SGN-U268615 Solanum tuberosum Build 4 92 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T390646 [Download][View] Facility Assigned ID: bf_cschxxxx_0025f09.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5