Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E590743

Search information 
Request: 590743Match: SGN-E590743
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C367756Clone name: 44345
nocartOrdering Not Available
Library Name: CSCHOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E590743Length: 786 bp (1050 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E590743 [] (trimmed) GAACCAAATGCTTCTACTTTTAACCCTATTTTTAGATGCATTGCCAAGGCTCGTGATGTAAATGCTGCTCATCGATTGTACGCCAAGATGAAGGA
GTTGAACTGTAAGCCTAATACAGTGACGTGCAACATATTGATGAAGATGTTTGTGGAATCAAAATCTACTGACATGGTTATCAAGCTCAGAAAAG
AAATGGACGAGAATGAAGTAGAGCCTAACGTGAACACTTTCAAGATTCTGATTTCCATGTACTGTGGGATGGGACATTGGAATAATGCTTATAAA
TATTTCAGAGAAATGATTGAGGAAAAGTGCTTGAGACCAAGTGAGTCGGTTTATGACATGGTTCTAAAACAATTAAGGAAGGCAGGGCAACTAAG
GAAACACGAAGAATTGGTGGAGAAGATGGTTGATCGGGGCTTTGCTACTCGTTCTGTGTAATAGGCGTTTGGAATGTGAACATATCAAAGCTTGG
AGGAGAAGCCTTTTTCGATCTTGCATTGGTACTCCACTCCTTCACTTTTGTCTACTTACTGCTGAAACATTTCAATCATAGTAGCGAATTCATTT
CCTTTTAGTAAGTTAAGTGAAGATCGTTTTTCTTTCTGCTGAATGATAACTTAATGAGAAATTTCACGCGTCTGTTGATCTCGGATAATCAACGT
AAAGACATTAGAGAGTATTTGATCTTTCAGTATAGAACTTTAACTTCGTATCAGGAATGTTTCCCTTCTAAATTTTTGAGTACATGGTACAAGAT
TTTGGCTTCCTTTTGGCTATGTAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E590743] SGN-U286037 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T391619 [Download][View] Facility Assigned ID: bf_cschxxxx_0036b03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0123 Quality Trim Threshold: 12.5