EST details — SGN-E592693

Search information 
Request: 592693Match: SGN-E592693
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C369706Clone name: 35907
nocartOrdering Not Available
Library Name: CSWBOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E592693Length: 307 bp (1156 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E592693 [] (trimmed) GACAAATCAGAAGCTCTTTCGCAGCAGTCATTGGTCGATCAACTAGGTCTCGACTCAATAACGGACAGAGAAGTCTGCTGTTACATGATCTCGTG
CAAGGATTCTGTAAATATCGATGCTGTTATCGATTGGCTAATCAAGCACTCAAAGACCGCGAAATGAAGAGCTGCCTCCGGGACATAATAATCTG
GAAAAATAGAATGTAGTTCTTTGAAAGGATCTTGAAATGATCTGTTAATATATTTTCTGGCTGATCTTTCTTTTGTTGGTTCTATATAGTTTTTT
TAATTAAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E592693] SGN-U278746 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T393569 [Download][View] Facility Assigned ID: bf_cswbxxxx_0002h11.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0004 Quality Trim Threshold: 12.5