EST details — SGN-E593758

Search information 
Request: 593758Match: SGN-E593758
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C370771Clone name: 36994
nocartOrdering Not Available
Library Name: CSWBOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E593758Length: 248 bp (998 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E593758 [] (trimmed) CTTTCTCTCTCTATCTCAGCTAAGACATTGAAGAAGACGAAGAACAGCAGCCAAGCAGAAGAATTCTCATATCTTTTTGCTTTGTATTTTTCTGT
GGTTTAATGGATCCATTCAATTATGTTTCGTCCATAATCGAGCTTCGTAAAGGGTTTGGGTGATATTGACTGCATAGTTGCGCCATCTTATAATT
AGAAGTTTCATGATGTATGTAGAGACCCTTTTTTCTTAACCATCTAGAAACAAGACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E593758] SGN-U276145 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T394634 [Download][View] Facility Assigned ID: bf_cswbxxxx_0014d02.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5